Products
| Product Number | Description | More Info |
|---|---|---|
| HMI0971-5NMOL | MISSION MICRORNA - HSA-MIR-940 | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-940 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: AAGGCAGGGCCCCCGCUCCCC Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0972-5NMOL | MISSION MICRORNA - HSA-MIR-941 | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-941 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: CACCCGGCUGUGUGCACAUGUGC Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0973-5NMOL | MISSION MICRORNA - HSA-MIR-941 | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-941 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: CACCCGGCUGUGUGCACAUGUGC Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0974-5NMOL | MISSION MICRORNA - HSA-MIR-941 | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-941 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: CACCCGGCUGUGUGCACAUGUGC Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0975-5NMOL | MISSION MICRORNA - HSA-MIR-941 | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-941 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: CACCCGGCUGUGUGCACAUGUGC Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0976-5NMOL | MISSION MICRORNA - HSA-MIR-942 | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-942 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: UCUUCUCUGUUUUGGCCAUGUG Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0977-5NMOL | MISSION MICRORNA - HSA-MIR-943 | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-943 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: CUGACUGUUGCCGUCCUCCAG Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0978-5NMOL | MISSION MICRORNA - HSA-MIR-944 | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-944 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: AAAUUAUUGUACAUCGGAUGAG Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0979-5NMOL | MISSION MICRORNA - HSA-MIR-95 | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-95 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: UUCAACGGGUAUUUAUUGAGCA Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0980-5NMOL | MISSION MICRORNA - HSA-MIR-96 | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 1.000 Unit Of Weight: G Purity Grade: hsa-miR-96 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: UUUGGCACUAGCACAUUUUUGCU Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0981-5NMOL | MISSION MICRORNA - HSA-MIR-96* | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-96* R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: AAUCAUGUGCAGUGCCAAUAUG Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0982-5NMOL | MISSION MICRORNA - HSA-MIR-98 | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 10.000 Unit Of Weight: G Purity Grade: hsa-miR-98 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: UGAGGUAGUAAGUUGUAUUGUU Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0983-5NMOL | MISSION MICRORNA - HSA-MIR-99A | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 1.000 Unit Of Weight: G Purity Grade: hsa-miR-99a R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: AACCCGUAGAUCCGAUCUUGUG Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0984-5NMOL | MISSION MICRORNA - HSA-MIR-99A* | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-99a* R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: CAAGCUCGCUUCUAUGGGUCUG Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0985-5NMOL | MISSION MICRORNA - HSA-MIR-99B | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 10.000 Unit Of Weight: G Purity Grade: hsa-miR-99b R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: CACCCGUAGAACCGACCUUGCG Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0986-5NMOL | MISSION microRNA MIMIC, HUMAN - hsa-mir- | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 1.000 Gross Weight: 1.000 Unit Of Weight: G Purity Grade: hsa-mir-2114 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: UAGUCCCUUCCUUGAAGCGGUC Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0987-5NMOL | MISSION microRNA MIMIC, HUMAN - hsa-mir- | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 1.000 Gross Weight: 1.000 Unit Of Weight: G Purity Grade: hsa-mir-2115 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: AGCUUCCAUGACUCCUGAUGGA Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0988-5NMOL | MISSION microRNA MIMIC, HUMAN - hsa-mir- | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 1.000 Gross Weight: 1.000 Unit Of Weight: G Purity Grade: hsa-mir-2116 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: GGUUCUUAGCAUAGGAGGUCU Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0989-5NMOL | MISSION microRNA MIMIC, HUMAN - hsa-mir- | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 1.000 Gross Weight: 1.000 Unit Of Weight: G Purity Grade: hsa-mir-2117 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: UGUUCUCUUUGCCAAGGACAG Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0990-5NMOL | MISSION microRNA MIMIC, HUMAN - hsa-mir- | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 1.000 Gross Weight: 1.000 Unit Of Weight: G Purity Grade: hsa-mir-2276 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: UCUGCAAGUGUCAGAGGCGAGG Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0991-5NMOL | MISSION microRNA MIMIC, HUMAN - hsa-mir- | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 1.000 Gross Weight: 1.000 Unit Of Weight: G Purity Grade: hsa-mir-2277 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: UGACAGCGCCCUGCCUGGCUC Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0992-5NMOL | MISSION microRNA MIMIC, HUMAN - hsa-mir- | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 1.000 Gross Weight: 1.000 Unit Of Weight: G Purity Grade: hsa-mir-2278 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: GAGAGCAGUGUGUGUUGCCUGG Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0993-5NMOL | MISSION microRNA MIMIC, HUMAN - hsa-mir- | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 1.000 Gross Weight: 1.000 Unit Of Weight: G Purity Grade: hsa-mir-449c R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: UAGGCAGUGUAUUGCUAGCGGCUGU Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0994-5NMOL | MISSION microRNA MIMIC, HUMAN - hsa-mir- | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 1.000 Gross Weight: 1.000 Unit Of Weight: G Purity Grade: hsa-mir-548q R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: GCUGGUGCAAAAGUAAUGGCGG Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0995-5NMOL | MISSION microRNA MIMIC, HUMAN - hsa-mir- | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 1.000 Gross Weight: 1.000 Unit Of Weight: G Purity Grade: hsa-mir-670 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: GUCCCUGAGUGUAUGUGGUG Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0996-5NMOL | MISSION microRNA MIMIC, HUMAN - hsa-mir- | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 1.000 Gross Weight: 1.000 Unit Of Weight: G Purity Grade: hsa-mir-711 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: GGGACCCAGGGAGAGACGUAAG Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0997-5NMOL | MISSION microRNA MIMIC, HUMAN - hsa-mir- | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 1.000 Gross Weight: 1.000 Unit Of Weight: G Purity Grade: hsa-mir-718 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: CUUCCGCCCCGCCGGGCGUCG Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0998-5NMOL | MISSION microRNA MIMIC, HUMAN - hsa-mir- | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 1.000 Gross Weight: 1.000 Unit Of Weight: G Purity Grade: hsa-mir-759 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: GCAGAGUGCAAACAAUUUUGAC Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0999-5NMOL | MISSION microRNA MIMIC, HUMAN - hsa-mir- | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 1.000 Gross Weight: 1.000 Unit Of Weight: G Purity Grade: hsa-mir-761 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: GCAGCAGGGUGAAACUGACACA Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI1000-5NMOL | MISSION microRNA MIMIC, HUMAN - hsa-mir- | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 1.000 Gross Weight: 1.000 Unit Of Weight: G Purity Grade: hsa-mir-762 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: GGGGCUGGGGCCGGGGCCGAGC Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI1001-5NMOL | MISSION microRNA MIMIC, HUMAN - hsa-mir- | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 1.000 Gross Weight: 1.000 Unit Of Weight: G Purity Grade: hsa-mir-764 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: GCAGGUGCUCACUUGUCCUCCU Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI1002-5NMOL | MISSION MICRORNA HSA-MIR-122 | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-122 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI1003-5NMOL | MISSION MICRORNA HSA-MIR-492 | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-492 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI1004-5NMOL | MISSION MICRORNA HSA-MIR-550A* | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-550a* R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI1005-5NMOL | MISSION MICRORNA HSA-MIR-99B* | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-99b* R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI1006-5NMOL | MISSION MICRORNA HSA-MIR-1233 | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-1233 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI1007-5NMOL | MISSION MICRORNA HSA-MIR-1184 | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-1184 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI1008-5NMOL | MISSION MICRORNA HSA-MIR-1184 | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-1184 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI1009-5NMOL | MISSION MICRORNA HSA-MIR-1302 | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-1302 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI1010-5NMOL | MISSION MICRORNA HSA-MIR-1302 | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-1302 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI1011-5NMOL | MISSION MICRORNA HSA-MIR-1302 | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-1302 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI1012-5NMOL | MISSION MICRORNA HSA-MIR-1244 | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-1244 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI1013-5NMOL | MISSION MICRORNA HSA-MIR-1244 | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-1244 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI1014-5NMOL | MISSION MICRORNA HSA-MIR-1254 | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-1254 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI1015-5NMOL | MISSION MICRORNA HSA-MIR-548O | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-548o R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI1016-5NMOL | MISSION MICRORNA HSA-MIR-1270 | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-1270 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI1017-5NMOL | MISSION MICRORNA HSA-MIR-548H | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-548h R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI1018-5NMOL | MISSION MICRORNA HSA-MIR-1972 | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-1972 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI1019-5NMOL | MISSION MICRORNA HSA-MIR-151B | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-151b R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI1020-5NMOL | MISSION MICRORNA HSA-MIR-2114* | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-2114* R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI1021-5NMOL | MISSION MICRORNA HSA-MIR-2115* | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-2115* R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI1022-5NMOL | MISSION MICRORNA HSA-MIR-2116* | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-2116* R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI1023-5NMOL | MISSION MICRORNA HSA-MIR-2681* | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-2681* R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI1024-5NMOL | MISSION MICRORNA HSA-MIR-2681 | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-2681 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI1025-5NMOL | MISSION MICRORNA HSA-MIR-2682 | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-2682 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI1026-5NMOL | MISSION MICRORNA HSA-MIR-2682* | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-2682* R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI1027-5NMOL | MISSION MICRORNA HSA-MIR-449C* | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-449c* R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI1028-5NMOL | MISSION MICRORNA HSA-MIR-2861 | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-2861 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI1029-5NMOL | MISSION MICRORNA HSA-MIR-2909 | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-2909 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI1030-5NMOL | MISSION MICRORNA HSA-MIR-3115 | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-3115 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI1031-5NMOL | MISSION MICRORNA HSA-MIR-3116 | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-3116 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI1032-5NMOL | MISSION MICRORNA HSA-MIR-3116 | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-3116 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI1033-5NMOL | MISSION MICRORNA HSA-MIR-3117-3P | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-3117-3p R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI1034-5NMOL | MISSION MICRORNA HSA-MIR-3118 | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-3118 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI1035-5NMOL | MISSION MICRORNA HSA-MIR-3118 | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-3118 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI1036-5NMOL | MISSION MICRORNA HSA-MIR-3118 | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-3118 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI1037-5NMOL | MISSION MICRORNA HSA-MIR-3118 | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-3118 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI1038-5NMOL | MISSION MICRORNA HSA-MIR-3118 | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-3118 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI1039-5NMOL | MISSION MICRORNA HSA-MIR-3118 | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-3118 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI1040-5NMOL | MISSION MICRORNA HSA-MIR-3119 | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-3119 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI1041-5NMOL | MISSION MICRORNA HSA-MIR-3119 | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-3119 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI1042-5NMOL | MISSION MICRORNA HSA-MIR-3120-3P | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-3120-3p R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI1043-5NMOL | MISSION MICRORNA HSA-MIR-3121-3P | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-3121-3p R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI1044-5NMOL | MISSION MICRORNA HSA-MIR-3122 | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-3122 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI1045-5NMOL | MISSION MICRORNA HSA-MIR-3123 | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-3123 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI1046-5NMOL | MISSION MICRORNA HSA-MIR-3124-5P | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-3124-5p R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI1047-5NMOL | MISSION MICRORNA HSA-MIR-548S | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-548s R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI1048-5NMOL | MISSION MICRORNA HSA-MIR-3125 | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-3125 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI1049-5NMOL | MISSION MICRORNA HSA-MIR-3126-5P | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-3126-5p R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI1050-5NMOL | MISSION MICRORNA HSA-MIR-3127-5P | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-3127-5p R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI1051-5NMOL | MISSION MICRORNA HSA-MIR-3128 | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-3128 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI1052-5NMOL | MISSION MICRORNA HSA-MIR-3129-5P | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-3129-5p R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI1053-5NMOL | MISSION MICRORNA HSA-MIR-3130-3P | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-3130-3p R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI1054-5NMOL | MISSION MICRORNA HSA-MIR-3130-3P | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-3130-3p R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI1055-5NMOL | MISSION MICRORNA HSA-MIR-3130-5P | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-3130-5p R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI1056-5NMOL | MISSION MICRORNA HSA-MIR-3130-5P | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-3130-5p R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI1057-5NMOL | MISSION MICRORNA HSA-MIR-3131 | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-3131 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI1058-5NMOL | MISSION MICRORNA HSA-MIR-3132 | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-3132 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI1059-5NMOL | MISSION MICRORNA HSA-MIR-3133 | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-3133 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI1060-5NMOL | MISSION MICRORNA HSA-MIR-378B | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-378b R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI1061-5NMOL | MISSION MICRORNA HSA-MIR-3134 | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-3134 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI1062-5NMOL | MISSION MICRORNA HSA-MIR-3135 | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-3135 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI1063-5NMOL | MISSION MICRORNA HSA-MIR-466 | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-466 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI1064-5NMOL | MISSION MICRORNA HSA-MIR-3136-5P | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-3136-5p R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI1065-5NMOL | MISSION MICRORNA HSA-MIR-544B | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-544b R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI1066-5NMOL | MISSION MICRORNA HSA-MIR-3137 | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-3137 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI1067-5NMOL | MISSION MICRORNA HSA-MIR-3138 | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-3138 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI1068-5NMOL | MISSION MICRORNA HSA-MIR-3139 | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-3139 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI1069-5NMOL | MISSION MICRORNA HSA-MIR-3140-3P | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-3140-3p R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI1070-5NMOL | MISSION MICRORNA HSA-MIR-548T | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-548t R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||