Products
| Product Number | Description | More Info |
|---|---|---|
| HLTUD2208 | LENTI MIRNA INHIB HUM HSA-MIR-6511A-5P | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12350000 Boiling Point: Storage Temperature: 0 Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 200 Gross Weight: 200 Unit Of Weight: MG Purity Grade: 0 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tariff Number: 30029090100 Technical Name: 0 Volume: 0.2 Unit Of Volume: ML |
||
| HLTUD2209 | LENTI MIRNA INHIB HUM HSA-MIR-6511A-3P | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12350000 Boiling Point: Storage Temperature: 0 Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 200 Gross Weight: 200 Unit Of Weight: MG Purity Grade: 0 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tariff Number: 30029090100 Technical Name: 0 Volume: 0.2 Unit Of Volume: ML |
||
| HLTUD2210 | LENTI MIRNA INHIB HUM HSA-MIR-6511B-5P | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12350000 Boiling Point: Storage Temperature: -70C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 200 Gross Weight: 200 Unit Of Weight: MG Purity Grade: hsa-miR-6511b-5p R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tough Decoy; TuD Tariff Number: 30029090100 Technical Name: 0 Volume: 0.2 Unit Of Volume: ML |
||
| HLTUD2211 | LENTI MIRNA INHIB HUM HSA-MIR-6511B-3P | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12350000 Boiling Point: Storage Temperature: -70C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 200 Gross Weight: 200 Unit Of Weight: MG Purity Grade: hsa-miR-6511b-3p R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tough Decoy; TuD Tariff Number: 30029090100 Technical Name: 0 Volume: 0.2 Unit Of Volume: ML |
||
| HLTUD2212 | LENTI MIRNA INHIB HUM HSA-MIR-6512-5P | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12350000 Boiling Point: Storage Temperature: -70C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 200 Gross Weight: 200 Unit Of Weight: MG Purity Grade: hsa-miR-6512-5p R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tough Decoy; TuD Tariff Number: 30029090100 Technical Name: 0 Volume: 0.2 Unit Of Volume: ML |
||
| HLTUD2213 | LENTI MIRNA INHIB HUM HSA-MIR-6512-3P | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12350000 Boiling Point: Storage Temperature: -70C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 200 Gross Weight: 200 Unit Of Weight: MG Purity Grade: hsa-miR-6512-3p R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tough Decoy; TuD Tariff Number: 30029090100 Technical Name: 0 Volume: 0.2 Unit Of Volume: ML |
||
| HLTUD2214 | LENTI MIRNA INHIB HUM HSA-MIR-6513-5P | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12350000 Boiling Point: Storage Temperature: -70C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 200 Gross Weight: 200 Unit Of Weight: MG Purity Grade: hsa-miR-6513-5p R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tough Decoy; TuD Tariff Number: 30029090100 Technical Name: 0 Volume: 0.2 Unit Of Volume: ML |
||
| HLTUD2215 | LENTI MIRNA INHIB HUM HSA-MIR-6513-3P | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12350000 Boiling Point: Storage Temperature: -70C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 200 Gross Weight: 200 Unit Of Weight: MG Purity Grade: hsa-miR-6513-3p R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tough Decoy; TuD Tariff Number: 30029090100 Technical Name: 0 Volume: 0.2 Unit Of Volume: ML |
||
| HLTUD2216 | LENTI MIRNA INHIB HUM HSA-MIR-6514-5P | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12350000 Boiling Point: Storage Temperature: -70C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 200 Gross Weight: 200 Unit Of Weight: MG Purity Grade: hsa-miR-6514-5p R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tough Decoy; TuD Tariff Number: 30029090100 Technical Name: 0 Volume: 0.2 Unit Of Volume: ML |
||
| HLTUD2217 | LENTI MIRNA INHIB HUM HSA-MIR-6514-3P | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12350000 Boiling Point: Storage Temperature: -70C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 200 Gross Weight: 200 Unit Of Weight: MG Purity Grade: hsa-miR-6514-3p R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tough Decoy; TuD Tariff Number: 30029090100 Technical Name: 0 Volume: 0.2 Unit Of Volume: ML |
||
| HLTUD2218 | LENTI MIRNA INHIB HUM HSA-MIR-6515-5P | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12350000 Boiling Point: Storage Temperature: -70C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 200 Gross Weight: 200 Unit Of Weight: MG Purity Grade: hsa-miR-6515-5p R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tough Decoy; TuD Tariff Number: 30029090100 Technical Name: 0 Volume: 0.2 Unit Of Volume: ML |
||
| HLTUD2219 | LENTI MIRNA INHIB HUM HSA-MIR-6515-3P | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12350000 Boiling Point: Storage Temperature: -70C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 200 Gross Weight: 200 Unit Of Weight: MG Purity Grade: hsa-miR-6515-3p R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tough Decoy; TuD Tariff Number: 30029090100 Technical Name: 0 Volume: 0.2 Unit Of Volume: ML |
||
| HLTUD2220 | LENTI MIRNA INHIB HUM HSA-MIR-6715A-3P | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12350000 Boiling Point: Storage Temperature: -70C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 200 Gross Weight: 200 Unit Of Weight: MG Purity Grade: hsa-miR-6715a-3p R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tough Decoy; TuD Tariff Number: 30029090100 Technical Name: 0 Volume: 0.2 Unit Of Volume: ML |
||
| HLTUD2221 | LENTI MIRNA INHIB HUM HSA-MIR-6715B-5P | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12350000 Boiling Point: Storage Temperature: -70C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 200 Gross Weight: 200 Unit Of Weight: MG Purity Grade: hsa-miR-6715b-5p R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tough Decoy; TuD Tariff Number: 30029090100 Technical Name: 0 Volume: 0.2 Unit Of Volume: ML |
||
| HLTUD2222 | LENTI MIRNA INHIB HUM HSA-MIR-6715B-3P | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12350000 Boiling Point: Storage Temperature: -70C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 200 Gross Weight: 200 Unit Of Weight: MG Purity Grade: hsa-miR-6715b-3p R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tough Decoy; TuD Tariff Number: 30029090100 Technical Name: 0 Volume: 0.2 Unit Of Volume: ML |
||
| HLTUD2223 | LENTI MIRNA INHIB HUM HSA-MIR-6716-5P | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12350000 Boiling Point: Storage Temperature: -70C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 200 Gross Weight: 200 Unit Of Weight: MG Purity Grade: hsa-miR-6716-5p R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tough Decoy; TuD Tariff Number: 30029090100 Technical Name: 0 Volume: 0.2 Unit Of Volume: ML |
||
| HLTUD2224 | LENTI MIRNA INHIB HUM HSA-MIR-6716-3P | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12350000 Boiling Point: Storage Temperature: -70C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 200 Gross Weight: 200 Unit Of Weight: MG Purity Grade: hsa-miR-6716-3p R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tough Decoy; TuD Tariff Number: 30029090100 Technical Name: 0 Volume: 0.2 Unit Of Volume: ML |
||
| HLTUD2225 | LENTI MIRNA INHIB HUM HSA-MIR-6717-5P | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12350000 Boiling Point: Storage Temperature: -70C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 200 Gross Weight: 200 Unit Of Weight: MG Purity Grade: hsa-miR-6717-5p R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tough Decoy; TuD Tariff Number: 30029090100 Technical Name: 0 Volume: 0.2 Unit Of Volume: ML |
||
| HLTUD2226 | LENTI MIRNA INHIB HUM HSA-MIR-6718-5P | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12350000 Boiling Point: Storage Temperature: -70C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 200 Gross Weight: 200 Unit Of Weight: MG Purity Grade: hsa-miR-6718-5p R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tough Decoy; TuD Tariff Number: 30029090100 Technical Name: 0 Volume: 0.2 Unit Of Volume: ML |
||
| HLTUD2227 | LENTI MIRNA INHIB HUM HSA-MIR-6719-3P | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12350000 Boiling Point: Storage Temperature: -70C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 200 Gross Weight: 200 Unit Of Weight: MG Purity Grade: hsa-miR-6719-3p R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tough Decoy; TuD Tariff Number: 30029090100 Technical Name: 0 Volume: 0.2 Unit Of Volume: ML |
||
| HLTUD2228 | LENTI MIRNA INHIB HUM HSA-MIR-6720-3P | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12350000 Boiling Point: Storage Temperature: -70C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 200 Gross Weight: 200 Unit Of Weight: MG Purity Grade: hsa-miR-6720-3p R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tough Decoy; TuD Tariff Number: 30029090100 Technical Name: 0 Volume: 0.2 Unit Of Volume: ML |
||
| HLTUD2229 | LENTI MIRNA INHIB HUM HSA-MIR-6721-5P | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12350000 Boiling Point: Storage Temperature: -70C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 200 Gross Weight: 200 Unit Of Weight: MG Purity Grade: hsa-miR-6721-5p R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tough Decoy; TuD Tariff Number: 30029090100 Technical Name: 0 Volume: 0.2 Unit Of Volume: ML |
||
| HLTUD2230 | LENTI MIRNA INHIB HUM HSA-MIR-6722-5P | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12350000 Boiling Point: Storage Temperature: -70C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 200 Gross Weight: 200 Unit Of Weight: MG Purity Grade: hsa-miR-6722-5p R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tough Decoy; TuD Tariff Number: 30029090100 Technical Name: 0 Volume: 0.2 Unit Of Volume: ML |
||
| HLTUD2231 | LENTI MIRNA INHIB HUM HSA-MIR-6722-3P | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12350000 Boiling Point: Storage Temperature: -70C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 200 Gross Weight: 200 Unit Of Weight: MG Purity Grade: hsa-miR-6722-3p R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tough Decoy; TuD Tariff Number: 30029090100 Technical Name: 0 Volume: 0.2 Unit Of Volume: ML |
||
| HLTUD2232 | LENTI MIRNA INHIB HUM HSA-MIR-6723-5P | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12350000 Boiling Point: Storage Temperature: -70C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 200 Gross Weight: 200 Unit Of Weight: MG Purity Grade: hsa-miR-6723-5p R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tough Decoy; TuD Tariff Number: 30029090100 Technical Name: 0 Volume: 0.2 Unit Of Volume: ML |
||
| HLTUD2233 | LENTI MIRNA INHIB HUM HSA-MIR-6724-5P | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12350000 Boiling Point: Storage Temperature: -70C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 200 Gross Weight: 200 Unit Of Weight: MG Purity Grade: hsa-miR-6724-5p R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tough Decoy; TuD Tariff Number: 30029090100 Technical Name: 0 Volume: 0.2 Unit Of Volume: ML |
||
| HLTUD2234 | LENTI MIRNA INHIB HUM HSA-MIR-892C-5P | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12350000 Boiling Point: Storage Temperature: -70C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 200 Gross Weight: 200 Unit Of Weight: MG Purity Grade: hsa-miR-892c-5p R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tough Decoy; TuD Tariff Number: 30029090100 Technical Name: 0 Volume: 0.2 Unit Of Volume: ML |
||
| HLTUD2235 | LENTI MIRNA INHIB HUM HSA-MIR-892C-3P | Expand |
|
CAS Number: Shipped on ICE/no ICE: Dryice UNSPSC Code: 12350000 Boiling Point: Storage Temperature: -70C Density: Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 200 Gross Weight: 200 Unit Of Weight: MG Purity Grade: hsa-miR-892c-3p R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tough Decoy; TuD Tariff Number: 30029090100 Technical Name: 0 Volume: 0.2 Unit Of Volume: ML |
||
| HMC0002-5NMOL | MISSION(R) MIRNA, NEGATIVE CONTROL 1 | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 1.000 Gross Weight: 20.000 Unit Of Weight: G Purity Grade: Sequence from Arabidopsis thaliana with no homology to human gene sequences R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tariff Number: 29349990900 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMC0003-5NMOL | MISSION MICRORNA NEGATIVE CONTROL 2 | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 1.000 Unit Of Weight: G Purity Grade: Sequence from Caenorhabditis elegans with no homology to human gene sequences R-Phrases: Radioactive Material: Specific Activity: Synonyms: Tariff Number: 29349990900 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0001-5NMOL | MISSION MICRORNA - HSA-LET-7A | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-let-7a R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: UGAGGUAGUAGGUUGUAUAGUU Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0002-5NMOL | MISSION MICRORNA - HSA-LET-7A* | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-let-7a* R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: CUAUACAAUCUACUGUCUUUC Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0003-5NMOL | MISSION MICRORNA - HSA-LET-7A | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 10.000 Unit Of Weight: G Purity Grade: hsa-let-7a R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: UGAGGUAGUAGGUUGUAUAGUU Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0004-5NMOL | MISSION MICRORNA - HSA-LET-7A-2* | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-let-7a-2* R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: CUGUACAGCCUCCUAGCUUUCC Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0005-5NMOL | MISSION MICRORNA - HSA-LET-7A | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-let-7a R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: UGAGGUAGUAGGUUGUAUAGUU Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0006-5NMOL | MISSION MICRORNA - HSA-LET-7A* | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-let-7a* R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: CUAUACAAUCUACUGUCUUUC Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0007-5NMOL | MISSION MICRORNA - HSA-LET-7B | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-let-7b R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: UGAGGUAGUAGGUUGUGUGGUU Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0008-5NMOL | MISSION MICRORNA - HSA-LET-7B* | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-let-7b* R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: CUAUACAACCUACUGCCUUCCC Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0009-5NMOL | MISSION MICRORNA - HSA-LET-7C | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 1.000 Unit Of Weight: G Purity Grade: hsa-let-7c R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: UGAGGUAGUAGGUUGUAUGGUU Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0010-5NMOL | MISSION MICRORNA - HSA-LET-7C* | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 1.000 Unit Of Weight: G Purity Grade: hsa-let-7c* R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: UAGAGUUACACCCUGGGAGUUA Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0011-5NMOL | MISSION MICRORNA - HSA-LET-7D | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-let-7d R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: AGAGGUAGUAGGUUGCAUAGUU Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0012-5NMOL | MISSION MICRORNA - HSA-LET-7D* | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-let-7d* R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: CUAUACGACCUGCUGCCUUUCU Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0013-5NMOL | MISSION MICRORNA - HSA-LET-7E | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 1.000 Unit Of Weight: G Purity Grade: hsa-let-7e R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: UGAGGUAGGAGGUUGUAUAGUU Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0014-5NMOL | MISSION MICRORNA - HSA-LET-7E* | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-let-7e* R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: CUAUACGGCCUCCUAGCUUUCC Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0015-5NMOL | MISSION MICRORNA - HSA-LET-7F | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-let-7f R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: UGAGGUAGUAGAUUGUAUAGUU Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0016-5NMOL | MISSION MICRORNA - HSA-LET-7F-1* | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-let-7f-1* R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: CUAUACAAUCUAUUGCCUUCCC Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0017-5NMOL | MISSION MICRORNA - HSA-LET-7F | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-let-7f R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: UGAGGUAGUAGAUUGUAUAGUU Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0018-5NMOL | MISSION MICRORNA - HSA-LET-7F-2* | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-let-7f-2* R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: CUAUACAGUCUACUGUCUUUCC Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0019-5NMOL | MISSION MICRORNA - HSA-LET-7G | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-let-7g R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: UGAGGUAGUAGUUUGUACAGUU Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0020-5NMOL | MISSION MICRORNA - HSA-LET-7G* | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-let-7g* R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: CUGUACAGGCCACUGCCUUGC Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0021-5NMOL | MISSION MICRORNA - HSA-LET-7I | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-let-7i R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: UGAGGUAGUAGUUUGUGCUGUU Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0022-5NMOL | MISSION MICRORNA - HSA-LET-7I* | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-let-7i* R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: CUGCGCAAGCUACUGCCUUGCU Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0023-5NMOL | MISSION MICRORNA - HSA-MIR-100 | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-100 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: AACCCGUAGAUCCGAACUUGUG Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0024-5NMOL | MISSION MICRORNA - HSA-MIR-100* | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-100* R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: CAAGCUUGUAUCUAUAGGUAUG Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0025-5NMOL | MISSION MICRORNA - HSA-MIR-101* | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-101* R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: CAGUUAUCACAGUGCUGAUGCU Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0026-5NMOL | MISSION MICRORNA - HSA-MIR-101 | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 1.000 Unit Of Weight: G Purity Grade: hsa-miR-101 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: UACAGUACUGUGAUAACUGAA Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0027-5NMOL | MISSION MICRORNA - HSA-MIR-101 | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-101 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: UACAGUACUGUGAUAACUGAA Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0028-5NMOL | MISSION MICRORNA MIMIC - HSA-MIR-103A | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-103a-1 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: AGCAGCAUUGUACAGGGCUAUGA Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0029-5NMOL | MISSION MICRORNA MIMIC - HSA-MIR-103B | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-103b-1 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: UCAUAGCCCUGUACAAUGCUGCU Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0030-5NMOL | MISSION MICRORNA MIMIC - HSA-MIR-103A-2* | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-103a-2 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: AGCUUCUUUACAGUGCUGCCUUG Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0031-5NMOL | MISSION MICRORNA MIMIC - HSA-MIR-103A | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-103a-2 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: AGCAGCAUUGUACAGGGCUAUGA Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0032-5NMOL | MISSION MICRORNA MIMIC - HSA-MIR-103B | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-103b-2 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: UCAUAGCCCUGUACAAUGCUGCU Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0033-5NMOL | MISSION MICRORNA - HSA-MIR-105 | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-105 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: UCAAAUGCUCAGACUCCUGUGGU Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0034-5NMOL | MISSION MICRORNA - HSA-MIR-105* | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-105* R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: ACGGAUGUUUGAGCAUGUGCUA Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0035-5NMOL | MISSION MICRORNA - HSA-MIR-105 | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-105 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: UCAAAUGCUCAGACUCCUGUGGU Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0036-5NMOL | MISSION MICRORNA - HSA-MIR-105* | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-105* R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: ACGGAUGUUUGAGCAUGUGCUA Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0037-5NMOL | MISSION MICRORNA - HSA-MIR-106A | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 1.000 Unit Of Weight: G Purity Grade: hsa-miR-106a R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: AAAAGUGCUUACAGUGCAGGUAG Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0038-5NMOL | MISSION MICRORNA - HSA-MIR-106A* | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-106a* R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: CUGCAAUGUAAGCACUUCUUAC Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0039-5NMOL | MISSION MICRORNA - HSA-MIR-106B | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 20.000 Unit Of Weight: G Purity Grade: hsa-miR-106b R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: UAAAGUGCUGACAGUGCAGAU Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0040-5NMOL | MISSION MICRORNA - HSA-MIR-106B* | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-106b* R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: CCGCACUGUGGGUACUUGCUGC Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0041-5NMOL | MISSION MICRORNA - HSA-MIR-107 | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 10.000 Unit Of Weight: G Purity Grade: hsa-miR-107 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: AGCAGCAUUGUACAGGGCUAUCA Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0042-5NMOL | MISSION MICRORNA - HSA-MIR-10A | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-10a R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: UACCCUGUAGAUCCGAAUUUGUG Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0043-5NMOL | MISSION MICRORNA - HSA-MIR-10A* | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-10a* R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: CAAAUUCGUAUCUAGGGGAAUA Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0044-5NMOL | MISSION MICRORNA - HSA-MIR-10B | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-10b R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: UACCCUGUAGAACCGAAUUUGUG Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0045-5NMOL | MISSION MICRORNA - HSA-MIR-10B* | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-10b* R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: ACAGAUUCGAUUCUAGGGGAAU Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0046-5NMOL | MISSION MICRORNA - HSA-MIR-1 | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 1.000 Unit Of Weight: G Purity Grade: hsa-miR-1 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: UGGAAUGUAAAGAAGUAUGUAU Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0047-5NMOL | MISSION MICRORNA - HSA-MIR-1178 | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-1178 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: UUGCUCACUGUUCUUCCCUAG Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0048-5NMOL | MISSION MICRORNA - HSA-MIR-1179 | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-1179 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: AAGCAUUCUUUCAUUGGUUGG Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0049-5NMOL | MISSION MICRORNA - HSA-MIR-1180 | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-1180 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: UUUCCGGCUCGCGUGGGUGUGU Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0050-5NMOL | MISSION MICRORNA - HSA-MIR-1181 | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-1181 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: CCGUCGCCGCCACCCGAGCCG Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0051-5NMOL | MISSION MICRORNA - HSA-MIR-1182 | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-1182 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: GAGGGUCUUGGGAGGGAUGUGAC Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0052-5NMOL | MISSION MICRORNA - HSA-MIR-1183 | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-1183 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: CACUGUAGGUGAUGGUGAGAGUGGGCA Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0053-5NMOL | MISSION MICRORNA - HSA-MIR-1184 | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-1184-1 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: CCUGCAGCGACUUGAUGGCUUCC Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0054-5NMOL | MISSION MICRORNA - HSA-MIR-1185 | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-1185 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: AGAGGAUACCCUUUGUAUGUU Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0055-5NMOL | MISSION MICRORNA - HSA-MIR-1185 | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-1185 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: AGAGGAUACCCUUUGUAUGUU Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0056-5NMOL | MISSION MICRORNA - HSA-MIR-1197 | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-1197 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: UAGGACACAUGGUCUACUUCU Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0057-5NMOL | MISSION MICRORNA - HSA-MIR-1 | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-1 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: UGGAAUGUAAAGAAGUAUGUAU Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0058-5NMOL | MISSION MICRORNA - HSA-MIR-1200 | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-1200 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: CUCCUGAGCCAUUCUGAGCCUC Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0059-5NMOL | MISSION MICRORNA - HSA-MIR-1201 | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-1201 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: AGCCUGAUUAAACACAUGCUCUGA Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0060-5NMOL | MISSION MICRORNA - HSA-MIR-1202 | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-1202 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: GUGCCAGCUGCAGUGGGGGAG Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0061-5NMOL | MISSION MICRORNA - HSA-MIR-1203 | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-1203 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: CCCGGAGCCAGGAUGCAGCUC Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0062-5NMOL | MISSION MICRORNA - HSA-MIR-1204 | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-1204 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: UCGUGGCCUGGUCUCCAUUAU Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0063-5NMOL | MISSION MICRORNA - HSA-MIR-1205 | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-1205 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: UCUGCAGGGUUUGCUUUGAG Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0064-5NMOL | MISSION MICRORNA - HSA-MIR-1206 | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-1206 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: UGUUCAUGUAGAUGUUUAAGC Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0065-5NMOL | MISSION MICRORNA - HSA-MIR-1207-5P | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-1207-5p R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: UGGCAGGGAGGCUGGGAGGGG Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0066-5NMOL | MISSION MICRORNA - HSA-MIR-1207-3P | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-1207-3p R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: UCAGCUGGCCCUCAUUUC Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0067-5NMOL | MISSION MICRORNA - HSA-MIR-1208 | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-1208 R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: UCACUGUUCAGACAGGCGGA Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0068-5NMOL | MISSION MICRORNA - HSA-MIR-122* | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 6.000 Unit Of Weight: G Purity Grade: hsa-miR-122* R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: AACGCCAUUAUCACACUAAAUA Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0069-5NMOL | MISSION MICRORNA - HSA-MIR-1224-5P | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-1224-5p R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: GUGAGGACUCGGGAGGUGG Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||
| HMI0070-5NMOL | MISSION MICRORNA - HSA-MIR-1224-3P | Expand |
|
CAS Number: Shipped on ICE/no ICE: No Ice UNSPSC Code: 12000000 Boiling Point: Storage Temperature: -20C Density: 0.0000 Drug Precursor: Dual Use Material: EINECSNo: 0 Flash Point: MDL Number: 0 Melting Point: Molecular Formula: Molecular Weight: Narcotic Permission: Net Weight: 5.000 Gross Weight: 5.000 Unit Of Weight: G Purity Grade: hsa-miR-1224-3p R-Phrases: Radioactive Material: Specific Activity: Synonyms: Mature Sequence: CCCCACCUCCUCUCUCCUCAG Tariff Number: 29349990700 Technical Name: 0 Volume: 0.000 Unit Of Volume: |
||